Natural variation in Human populations (or Why its difficult to talk about race and genetics in the same sentence)

For many centuries Humans have been dividing themselves up into different groups or 'races' and then assigning characteristics to these groups, sometimes it's physical characteristics, skin colour, eye colour, the shape of eyes or noses, sometimes it personal or emotional characteristics, and in the way of humans these tend to be divided by those with the power into 'us' = good characteristics, 'others' = bad characteristics.

As a result of developments in genetics in the later half of the 20th century, and the first few decades of the 21st, geneticists have been able to delve into the genetics of race to determine whether these assumptions have any real basis on genetic fact.

And it turns out, race is pretty difficult to define using genetics.

I don't want you to come away from this thinking there are no average genetic differences between populations (i.e. races), there are, and you can plot them quite nicely. In the plot below the populations are separated using genetic comparisons, individuals from each population share a colour.  You can see that although the populations tend to cluster together, many populations overlap. You can also clearly see that genetic distances and geographical distances have a strong correlation as the plot looks very similar to the map on the right.

People who live closely together, are more likely to share genetic characteristics, but as with almost all things in biology these differences exist on a spectrum. These populations have been mapped using specific markers that are known to differ widely through populations, across the whole genome though, humans are 99.9% the same as each other.

If you picked any individual and tried to plot it on that map, you might end up with a good idea of which population the individual came from (this is what companies like 23andMe do), or you might end up with four or five different possibilities as the populations don't have clear dividing lines.

There are several reasons for this difficulty with assigning an individual to a specific nationality or race using genetics.

1.  The main characteristics that we think of as associated with race are fairly superficial, i.e skin colour (which can vary dramatically within populations), and are often the result of multiple alleles (version of a gene) on multiple genes. These visual characteristics have not been shown to be genetically linked to the personal or emotional characteristics assigned to the groups (genetic linkage is when one characteristic is nearly always found along side a different characteristic due to there being a very short distance between them).

2. Humans started to move out of Africa less than 100,000 years ago. This may seem like a long time ago, but in evolutionary terms, it's really short. It certainly isn't enough time for one group of a species to have evolved significant, and consistent, differences to another group.

3. Variable positions in genes that effect the outcome of that gene (affecting for example, eye colour), exist in different proportions in different populations and vary across geographical space.  It is much more usual for a population to have a mix of these alleles than it is for the population to have only one or the other of the alleles.

The diagram below shows the proportions of an ancestral allele (original version of the gene) and a derived allele (new version of the gene). You can see that in Africa, the original version is more common, but it is not the only version found, while as you move out towards the pacific the proportion of the derived allele gets larger and larger.

The map above comes from Scheinfeldt et al., 2011

4. Populations aren't static. We can show by looking at the genetics of one population, that they tend to be a mix of various other populations. Where populations have been separated and then an influx has occurred from another population, we call this admixture. Migrations, into the Americas for example, can quite clearly be seen by quantifying this admixture. As well as admixture, there is also continuous movement of populations, in some regions, which would allow for the movement of alleles from one population to another.

TAKE HOME MESSAGE

The ranges of genetic characteristics from different 'races' overlap each other, but alleles do exist in different proportions in different populations. Given the genetic make up of an individual, you could give a likelihood of where that individual came from and where their ancestors came from, but you'd be very unlikely to be able to say for certain.

Disclaimer: There are other factors to think about when talking about race, such as cultural heritage, assumptions, aspirations, opportunities etc. It is a VERY BIG TOPIC and I am not qualified to talk about those things! This post is not meant to reduce that VERY BIG TOPIC, but simply to point out that there is no real clear dividing line between 'races' when using genetics as a means of measuring it.

What are Transposable Elements?

Transposable Elements (sometimes also called transposons or mobile DNA; referred to from now on as TEs) are small sections of DNA which have the ability to move around the genome.

TEs were first discovered by Barbara McClintock around 1950. Her discovery of transposable elements was not immediately understood or accepted by her contemporaries. As we have learned more about the structure of the genome and about DNA in general, we have come to understand more about these interesting elements, although they can still be very confusing.

The first thing to know about TEs is that they mostly don't have a function in the host organisms (as far as we are aware). Some individual elements have been co-opted as part of a gene, or a part of the control mechanisms for switching genes on or off and it has also been suggested that TEs help to regulate the size of the genome, but in general, they are 'selfish DNA', they exist just to replicate themselves.

The second thing to know about TEs in that they take up a huge proportion of our genome. Far more than the protein coding genes do.

Image taken from http://bio1510.biology.gatech.edu/module-4-genes-and-genomes/4-8-genomes/

In the image above those segments labelled Lines, Sines, LTR retrotransposons and DNA transposons are all TEs.

How do TEs move?

There are two main types of TEs: DNA TEs and RNA TEs.

DNA TEs are often referred to as cut-and-paste elements. This is because the DNA is removed from its original position and inserted into a new postition. Often this results in elements moving around without increasing in number, however if the cut-and-paste event (called transposition) occurs during the right part of the cell cycle, when the DNA is being copied, then it can result in two elements, one in the original position and one in the new position.

RNA TEs are referred to as copy-and-paste. These elements created a template of themselves using RNA, much like protein coding genes do.  This then leaves the original element where it is and a new piece of DNA is created using the template, the new DNA is inserted in a different position in the genome. This means that this type of TE always increases in number when a transposition event occurs.

Evolution - don't anthropomorphise it

All too often we hear people talking about evolution as if has wants and desires, we anthropomorphise genes, assigning goals and thought processes to them.  Genetic material is just doing it's thing, it doesn't know what direction to go in, it doesn't have an end point as a goal. Instead mutations happen. The mutations might be positive, they might be negative or they might not make much difference. The negative mutations are unlikely to lead to a long term change as the organism who have them won't be able to compete as well. The ones that don't do anything might stick around, but equally they might not.  The ones that have positive effects, even if they're only small, are likely to spread through the gene pool, becoming more and more common as the organisms who have them are likely to mate more successfully than those that don't. In order for the organism to end up with a certain complex characteristic each step along the way needs to be beneficial (or at least not detrimental) because there is no way of 'looking at the larger picture', or of having a long term goal, in evolution.

Let's think about the evolution of sight. There was no map showing how to evolve eyes and there are in fact a number of different sight mechanisms found in nature. Insects and humans have very different eyes, for example.

 Eyes evolved through a long process in which mutations gave an organism improved abilities to be aware of it's surroundings.  There was no end goal of developing eyes and a mutation which would theoretically help create eyes in the long term, but which would be immediately detrimental, would not long survive in the gene pool.  It is likely that sight developed initially though a mutation which gave certain cells light sensitivity, enabling the organism to move towards or away from light sources. We can see this response in plants, which don't have eyes but do have an ability to grow towards the light.  There's no specific reason that plants didn't evolve to have eyes, they just haven't accumulated mutations which could lead to eyes in a way that gives the organism an advantage over others.

So when you're thinking about evolution, think about the short term. We can only think about the evolution towards a certain trait in hindsight. Genetic material doesn't know what it's doing.

That 10% of your Brain Claim

While I was watching TV the other day, a trailer for the film Lucy came on.  I'm a big Sci-Fi and Fantasy fan, so normally something like this would be right up my street, but the entire premise of this film annoys me.

One of the defining features of Science Fiction is that it is meant to be based on Science fact and extrapolated.  To quote Robert A. Heinlein: 

"a handy short definition of almost all science fiction might read: realistic speculation about possible future events, based solidly on adequate knowledge of the real world, past and present, and on a thorough understanding of the nature and significance of the scientific method."

 This science fiction film is based on a scientific myth, and more annoyingly from my perspective, a myth that is related to my field.

So in case you haven't seen the trailer yet, Lucy is based on the idea that humans only use 10% of their brains.  It's a myth (with sometimes varying levels of brain use) that's been going around for at least 100 years and there are various origin stories.  It's not entirely clear how the myth started, but what is clear is that it is a myth.  Neuroscientists have refuted it from a neuroscience perspective, but here I'd like to talk about why it's ridiculous from a evolutionary point.

There are plenty of occasions where there are parts of humans which are not very (or at all useful). Working on Transposons, I am well aware that much of our DNA, for example, is useless.  However, for something that is not useful to stick around, it means that it needs to be less (or the same level of) harmful to keep it, than it is to get rid of it.  In other words, we can have useless neutral traits, but if the trait is detrimental, organisms without it are likely to have a higher level of fitness than those with it.

Only using 10% of our brains is very unlikely to fall into this neutral category.  One of the main effects of human brain size is that we need to have a large skull to fit it in.  The size of the human skull versus the size of the human pelvis is a big reason for the short length of gestation time we have compared to other large mammals.  This means that our infants are helpless when born and need a lot more care and energy expended on looking after them.  The large skull size also leads to mothers and children dying in childbirth, sure we have c-sections now and a lot less deaths, but in evolutionary terms, that's so recent to not have an effect.

Another reason a 90% useless brain would be unlikely to develop is that it's a really expensive organ.  It uses huge amounts of energy and oxygen, which would be a massive waste of resources.  An individual with a smaller brain that was utilized more (giving the same amount of brain power) would almost definitely be able to out compete it. 

So I'm unlikely to go and see Lucy, because despite being an expert at suspension of disbelief, this is all just a step too far for me.

The battle over Junk

Back in the very early days of molecular genetics, it was assumed that the genome was almost exclusively made up of genes.  However, once we started to sequence genomes, it soon became very clear that a large part of most genomes did not consist of genes at all, but instead consisted of 'junk'.

Junk DNA is a fairly loose term which includes all the parts of the DNA that don't seem to have a function in the species.  Junk DNA is just there, it doesn't seem to have a function.

Recently however, a debate has started about how much 'Junk' DNA there is and what should be included in our definition of 'Junk'.  The ENCODE project is a project which is attempting to build a catalogue of all the 'functional' elements (an element can be thought of as a specific sequences of DNA) in the human genome.  This includes all elements that do something, bind to a protein for example, but it does not take into account whether this function goes on to have an effect on the species (humans in this case).

The Encode project gave some fairly high profile press conferences stating that Junk DNA basically didn't exist, because from a biochemical point of view, most of the DNA 'did something'.  The evolutionary geneticists took a stand against this, their point being that it didn't matter whether the DNA did anything biochemically, if it didn't have an effect on the organism, it was still junk.  It's important at this stage to think about the difference between 'Junk' and 'Rubbish'

Here's a quote from Sydney Brenner explaining it.

‘Some years ago I noticed that there are two kinds of rubbish in the world and that most languages have different words to distinguish them. There is the rubbish we keep, which is junk, and the rubbish we throw away, which is garbage. The excess DNA in our genomes is junk, and it is there because it is harmless, as well as being useless, and because the molecular processes generating extra DNA outpace those getting rid of it. Were the extra DNA to become disadvantageous, it would become subject to selection, just as junk that takes up too much space, or is beginning to smell, is instantly converted to garbage . . . ”.

Lots of the evolutionary geneticists have pointed out that we would expect this junk DNA to 'do things' because lots of it is there as a result of it being useful DNA in a past ancestor species, just as the junk in your garage does stuff, it's just not necessarily useful stuff, and because it wasn't doing anything harmful once it lost it's purpose, it was just left there.

It's a really interesting debate, I might talk some more about it in the future as junk DNA is one of the subjects I research.  In the meantime, if you're interested in the arguments, there are a lot of other blogs and articles which go into greater detail than I have here.

Apologies

Apologies for the lack of a new post in the last few weeks.  I should be back to posting regularly next week.

Research & Real Life kind of got in the way.

Positive Selection

Positive selection is one of the great driving forces in evolution.  It is probably the thing we think of most when we're talking about natural selection and survival of the fittest.

Positive selection is a force that acts on a beneficial mutation and causes it to occur more often in the population.

Let's say that an individual in a population has a mutation that gives it some advantage over others.  Maybe it gives it slightly better eye sight so that it can see predators coming more easily, or maybe it helps it survive harsh conditions, or improves fertility.  There are all sort of reasons that a mutation could be beneficial.

In each of these cases, the new mutation helps the individual survive to pass on its DNA to more offspring.  That's basically the point of life from a genetic point of view.  The fitter you are, the more you pass on your DNA.

So, if the individual manages to pass on their DNA more because of a new mutation that they have, this mutation will enter the population more times in the next generation that a non-beneficial mutation would have (because they have more offspring).  And then their children who have this mutation, will pass on their DNA more often as well.

The mechanism causes the mutation to rapidly increase in frequency in a population.  This is called a sweep (and is researched in great depth in the lab I work in).  The speed at which the mutation sweeps through a population depends on how beneficial it is compared to other alleles.  If it is only slightly better, it will take a long time to increase in frequency, if it is much better this process will occur much faster.

If a mutation is particularly beneficial it will probably reach fixation in the population.  This means that all individuals in the population now have the beneficial mutation and there are no other versions.  It is through this process that new species can evolve.

Puzzling acroymns - SNPs

Just as I was sitting down, deciding what to write this post on, someone asked me on twitter "What are SNPs"?

Every profession and area of study has a bunch of acronyms and field specific terms that can be very confusing to those outside the field.  Genetics is no different and SNP is one of our worst.

SNP stands for Single Nucletide Polymorphism.

No clearer, huh?

Okay, lets start at the end.  Polymorphisms are when there is more that one version of a gene in the population - think eye colour and have a look at my post here.

When we talk about Single Nucleotide Polymophisms it means that at one specific position in the genome, some individuals will have one nucleotide and some individuals will have a different nucleotide.

There are a huge number of positions where this occurs and they're all categorised in a database.  Many of the differences have no apparent function, others cause changes but neither option is better than the others. Other rare SNPs may be involved in genetic diseases.

SNPs are very useful in genetics for a number of reasons. One of the big uses in is Genome Wide Association Studies, which allow us to find regions of the genome which are associated with certain traits or diseases.  The SNPs themselves may not actually be involved, but nearby regions maybe.  We'll talk more about this when I get onto recombination.

Another reason why it's important to know about SNPs is in looking for the genetic mutation causing someone's disease.  When their gene is sequenced and compared to the human reference genome, a number of different mutations may come up.  It's important to be able to rule out the ones that we know are common and are therefore unlikely to be causing the disease.

So that's it, SNPs demystified.  They're just single nucleotide substitutions, we just gave them a complicated name.

Convergent Evolution

I've been working on a project recently which involves convergent evolution, so I thought I'd talk about that.

When we see the same trait in different species it is often because these species have an ancestor in common that developed the trait, passing it on to the species that later develop from it. This is similar to a parent passing on a trait to their children, such as eye colour.

A nice trait to think of in this way is the ability to incubate young in the womb versus laying eggs.

We assume that egg laying was the original condition and that an ancestor species of mammals (another term for mammals which incubate their young in-utero is Eutherians) developed the ability to incubate young in its womb instead - a feature which has a lot of benefits for the safety of the unborn young, such as protection from the elements or from predators. From phylogenetic studies we know that all mammals have a common ancestor which they don't share with reptiles, birds or fish - all of which lay eggs.

There are other species which help to show the development of this trait - Marsupials, for example, which don't lay eggs but incubate their young in external pouches, such as the kangaroo. There is also a further group of mammals which lay eggs (Monotremes), the platypus is an example of this. They are grouped with other mammals because of other mammalian traits they have, such as warm bloodedness, but they show us an intermediate stage of the development of the ability to incubate their young in the womb.


(image from http://palaeo.gly.bris.ac.uk/palaeofiles/marsupials/Index.htm)

Anyway, that was a bit of a sidetrack, because that trait is not an example of convergent evolution. Convergent evolution is when, rather than multiple species inheriting a trait from an ancestor species, the trait evolves independently in different species.

An example of this is the ability to fly. Both birds and bats possess the ability to fly. However, the bat is a mammal and much more closely related to other, non-flying mammals than it is to bats. If you only know this information it would be possible to assume that flight was lost in other mammals and it was an ancestral trait retained in bats. However, if you look at the structure of a bird and a bat wing, you can see that they are very different.


(image from http://evolution.berkeley.edu/evosite/evo101/IIC1Homologies.shtml)

With some traits, like flight, it is fairly simple to determine if covergent evolution has occurred. However with other traits it can be much more difficult, at which point a comparison at the DNA level is needed to determine the similarity between species.

Mendelian genetics - that bit with the monk

Gregor Mendel was an Augustinian monk who lived in the 19th Century.  He gave us some of the first quantifiable evidence for genetic inheritance and the type of genetics he described is named after him.

   

Mendel was a gardener at the monastary, he grew peas.  While he was growing the peas, he observed what happened when you breed a plant with one trait against a plant with a different trait. What he found was a set of ratios that are always the same in the offspring.

This is the bit where we could come to those crosses you might remember from high school, but I'm actually going to leave that for another day.  I will, however try to explain a bit about Mendelian genetics without resorting to drawing crosses.

Every gene that you have has two copies (unless your a guy, then you X & Y makes thing a bit more complicated).  This is because you have paired chromosomes like this: 

One of your copies came from your mother and one from your father and they can be slightly different (the different copies are called alleles).  For example your parents may have had different coloured eyes, so they might be passing you slightly different version of the eye colour genes.  Don't forget that your parents had two copies as well - so they might have different types which could be passed to you.

Let's say you received a blue eye colour allele from your father and a brown eye colour allele from your mother.  How can we predict what colour eyes you have?

Well, Mendelian genetics relies on the concept of recessive and dominant alleles.  A dominant allele only has to have one copy to show, but a recessive allele need two copies to show.  In the case of your eye colour, we know from experiments that the brown allele is dominant and the blue allele is recessive.  This means that you would have brown eyes.

Mendel noticed that certain traits in his peas were dominant and some were recessive.  Traits he looked at included things like: shape (wrinkled or round) and seed colour (yellow or green).

Unfortunately, although Mendel published his work at the time, it didn't reach the wider scientific community and had to wait until the early 20th century when the same conclusions were independently discovered by other researchers.  Previously to this work being discovered it was assumed that traits in the offspring were a merging of the traits in the parents rather than a case of either/or.

The other interesting point to make is that, knowing what we now know about statistics and probability, it appears that Mendel may have either tweaked some of his results or played around with the plants until he got ones which showed exactly the results he wanted - the ratios are just too good, it wouldn't happen in a modern experiment.  However, we shouldn't really judge him too harshly, biology in the 19th century was mostly observation and very little planning of experiments, so he probably wasn't doing anything that the others wouldn't have been doing.

Phylogeny or the Tree of Life

The tree of life was originally suggested by Darwin as a way of explaining the relationships between different species.  It's a lot like a family tree in both form and function.  The study of these trees is called phylogenetics.

 

A modern phylogenetic tree (that's the correct term) looks something like this:

If we look at the group at the bottom of the tree, these are all apes (humans count in this group too).  We can see that Bonobos and Chimpanzees are the most closely related, with Humans next to them.

One of the important things that people often get wrong about evolution is the idea that we 'descended from monkeys'.  If you look at the tree, each of the tips represents a modern species, but the next branch up, from where two species combine, represents a species that was somewhat similar to each of the modern species, but it wasn't exactly the same as any of them.  Sometimes we have fossil records for these species, sometimes we don't.  So when people say 'we descended from monkeys', it is closer to the truth to say both monkeys and humans descended from a common ancestor species in the fairly recent past (on an evolutionary timescale).

If you're interested in learning more about 'common ancestor' species. There's a fun website called Timetree.org which will show you the time at which researchers think that the speciation event (the branching that you can see on the tree) happened for different pairs of species.  This gives you an idea of when the common ancestor species might have lived.

You can also find out some interesting facts about which animals are most closely related to each other.  Some that I find amusing are:

Dogs vs Cats - 55 Million years ago
but
Dogs vs Pandas - 45 Million years ago (you'll have to use the latin name for Panda - Ailuropoda)

Cows vs Horses - 82 Million years ago
but
Cows vs Whales - 56 Million years ago

What is 'The Genome'

'The genome' is one of those phrases that gets thrown around a lot.  All species have a genome, but I'm just going to specifically talk about the human genome today.  You may have read in the news that the first draft of the Human Genome Project was published in 2000, and then may have read all about it again in 2003 when a further refined version was published.  It's still not really 'complete'.

So what do we mean when we talk about 'the human genome'?

In it's most basic form it's all the DNA that is found in a human.  Except, we're all slightly different from each other (I have blue eyes, you may have brown eyes), also within you your cells don't all have the same DNA - there will be slight mutations, lots of these won't do anything, but they're also the changes that can lead to cancer.  So when we talk about the genome, we really mean a sort of averaged version of the DNA found in a human - it's often referred to as a reference genome.

Except we usually also leave out the DNA found in mitochondria, because it doesn't quite count...

Okay, so when we talk about 'the human genome', we mean all the DNA in a human (averaged, with some left out), right?

Sort of.  That's the basic level of information, but just the DNA code on it's own isn't that much use to anyone.  So, we also include the annotation (other information that we can attach to it), such as:

Where are the genes?
What do those genes do?
What about DNA that tells the genes when to be on or off (promoters, Transcription Factors)?
What about other weird bits of DNA like transposons (I'll talk about these soon as it's what I'm really interested in)?

A fairly recent project (which you may have also heard about in the news) called the 1000 genome project aims to reduce some of the averaging that goes on with the human genome.  This project will allow us to look at differences between the genomes of different people and differences across different populations.  But it still won't be a complete map of all the differences in the human genome.

The $1000 genome project aims to provide people with their own genome for $1000 (does what it says on the tin!), it's not in a great state at the moment, but as genome sequencing get cheaper and easier we get further along the journey towards really understanding the human genome.

Intro to Molecular Genetics

When we talk about genetics, what are we actually talking about?  Sometimes it seems a bit abstract, traits like eye colour get passed from parents to offspring and depending on which type is dominant or recessive it shows up (or doesn't show up) in the offspring.  Is this bring back memories of drawing crosses in GCSE biology?  Is it all a bit hazy? Never mind if it is, we'll get to that.  Today, we're not going to worry about what genetics does, we're just going to think about what it is, on a molecular level.

The molecule we're most interested in is DNA.  This stands for Deoxyribonucleic acid, the only reason you'll ever need to remember its full name is for a pub quiz, so I wouldn't worry too much about it.  It looks like this:


Well, if we're being honest, it doesn't really.  But this is a nice representation for now.

The overall shape is called a double helix, the red and orange bits running up the side are referred to as the backbone and the blue and white bits through the middle (the bits that look like a rung on a ladder) are called nucleotides.  It's the nucleotides that we're really interested in.  At some later date I might talk about the discovery of this structure, it's a good story, but it's a story for another time.

Nucleotides are the code that tells our body how to function, they're the bit that makes us human rather than chimpanzees or bananas.  Nucleotides come in 4 types: Adenine (A), Cytosine (C), Guanine (G), Thymine (T).  If you look closely at the diagram above, you can see that there are actually two nucleotides, one from each backbone, for each rung on the DNA ladder.  These nucleotides always pair in exactly the same way Adenine pairs with Thymine and Cytosine pairs with Guanine.  This means that we only need to worry about one side of the DNA molecule.

As we only need to worry about one side we can represent the nucleotides in the DNA something like this:

ATGCTGTCACCAAACTTGGAAAAAAAGTCACACGTATAA

Okay, so now we know (a bit) about DNA.  But what does it do? How does it make us human?

This is the first dogma of molecular biology (there are exceptions, but we won't worry about that):
DNA -> RNA (an intermediate step that we'll worry about another time) -> Protein

Proteins are the things that actually do things in the body.  One protein will make your eyes blue, a slight change in that protein will make your eyes green.  So how do we get from DNA to protein?

Each three letters of DNA (called a codon) codes for a specific amino acid - amino acids are the building blocks that make up a protein.  You can see here the different codes that give you different proteins.




So the string of nucleotides that I wrote further up would give us:
Met-Leu-Ser-Pro-Asn-Leu-Glu-Lys-Lys-Ser-Gln-Val-Stop

We commonly use a 3 letter code to name each of the amino acids, but they also have full names (and 1 letter codes that you can use instead).  You can find out more about that here.  Different amino acids have different properties, so if you change one in a protein it can alter what the protein does.  You can find out more here (it's fairly complicated, I might write an easier one at some point!)

A protein always starts with a Met and always ends on a stop codon.  That's how the body knows that the DNA stops being part of this protein and starts being part of something else.

So now you know a bit about DNA and molecular genetics.

Genetics for Non-Geneticists

As a rather late New Year's Resolution, and as an effort to improve my popular science writing, I've decided to start writing about genetics for non-geneticists.  And the resolution bit of it is that I'm going to try to put up a new blog post every Monday.

I know from talking to friends and family that there's a large body of people out there who think genetics is really interesting, but have no (or very little) formal training in it.  This blog is for those people.  Sometimes I'll write primers for a specific genetics topic and sometimes I'll write about genetics in the news or pop-culture.  But the aim throughout it is to try and make it accessible to non-geneticists.  So if you read a post and it goes above your head, call me out on it and I'll try and do better.

Wish me luck.