The molecule we're most interested in is DNA. This stands for Deoxyribonucleic acid, the only reason you'll ever need to remember its full name is for a pub quiz, so I wouldn't worry too much about it. It looks like this:
Well, if we're being honest, it doesn't really. But this is a nice representation for now.
The overall shape is called a double helix, the red and orange bits running up the side are referred to as the backbone and the blue and white bits through the middle (the bits that look like a rung on a ladder) are called nucleotides. It's the nucleotides that we're really interested in. At some later date I might talk about the discovery of this structure, it's a good story, but it's a story for another time.
Nucleotides are the code that tells our body how to function, they're the bit that makes us human rather than chimpanzees or bananas. Nucleotides come in 4 types: Adenine (A), Cytosine (C), Guanine (G), Thymine (T). If you look closely at the diagram above, you can see that there are actually two nucleotides, one from each backbone, for each rung on the DNA ladder. These nucleotides always pair in exactly the same way Adenine pairs with Thymine and Cytosine pairs with Guanine. This means that we only need to worry about one side of the DNA molecule.
As we only need to worry about one side we can represent the nucleotides in the DNA something like this:
ATGCTGTCACCAAACTTGGAAAAAAAGTCACACGTATAA
Okay, so now we know (a bit) about DNA. But what does it do? How does it make us human?
This is the first dogma of molecular biology (there are exceptions, but we won't worry about that):
DNA -> RNA (an intermediate step that we'll worry about another time) -> Protein
Proteins are the things that actually do things in the body. One protein will make your eyes blue, a slight change in that protein will make your eyes green. So how do we get from DNA to protein?
Each three letters of DNA (called a codon) codes for a specific amino acid - amino acids are the building blocks that make up a protein. You can see here the different codes that give you different proteins.
So the string of nucleotides that I wrote further up would give us:
Met-Leu-Ser-Pro-Asn-Leu-Glu-Lys-Lys-Ser-Gln-Val-Stop
We commonly use a 3 letter code to name each of the amino acids, but they also have full names (and 1 letter codes that you can use instead). You can find out more about that here. Different amino acids have different properties, so if you change one in a protein it can alter what the protein does. You can find out more here (it's fairly complicated, I might write an easier one at some point!)
A protein always starts with a Met and always ends on a stop codon. That's how the body knows that the DNA stops being part of this protein and starts being part of something else.
So now you know a bit about DNA and molecular genetics.
No comments:
Post a Comment